Skip to main content
Ch. 16 - Genomics: Genetics from a Whole-Genome Perspective
Sanders - Genetic Analysis: An Integrated Approach 3rd Edition
Sanders3rd EditionGenetic Analysis: An Integrated ApproachISBN: 9780135564172Not the one you use?Change textbook
Chapter 16, Problem B.14f

Select one of the hereditary conditions from either the RUSP core conditions list or the RUSP list of secondary conditions and do some online research to find the following information:
The anticipated outcome if treatment is applied

Verified step by step guidance
1
Choose a hereditary condition from the Recommended Uniform Screening Panel (RUSP) core conditions or secondary conditions list. For example, you might select Phenylketonuria (PKU), a well-known genetic metabolic disorder.
Research the condition to understand its genetic basis, typical symptoms, and how it affects the body. This will help you grasp why early treatment is important.
Identify the standard treatment or intervention used for the condition. For PKU, this involves a strict diet low in phenylalanine to prevent harmful buildup.
Investigate the anticipated outcomes when treatment is applied early and consistently. Focus on how treatment can prevent or reduce symptoms, improve quality of life, and avoid complications.
Summarize your findings by explaining the importance of newborn screening for the condition and how timely treatment changes the prognosis compared to untreated cases.

Verified video answer for a similar problem:

This video solution was recommended by our tutors as helpful for the problem above.
Video duration:
3m
Was this helpful?

Key Concepts

Here are the essential concepts you must grasp in order to answer the question correctly.

Newborn Screening and the RUSP

The Recommended Uniform Screening Panel (RUSP) is a list of genetic and metabolic conditions recommended for newborn screening in the U.S. It includes core and secondary conditions that can be detected early to prevent severe health issues. Understanding RUSP helps identify which hereditary conditions are routinely screened and why early detection is critical.
Recommended video:
Guided course
09:32
History and Experiments

Hereditary Genetic Conditions

Hereditary conditions are disorders passed from parents to offspring through genes. These conditions often involve mutations that affect normal biological functions. Recognizing the genetic basis of these diseases is essential for understanding their diagnosis, prognosis, and treatment options.
Recommended video:
Guided course
09:03
Modern Genetics

Impact of Early Treatment on Genetic Disorders

Early treatment of genetic conditions, especially those identified through newborn screening, can significantly improve health outcomes by preventing or reducing symptoms. Treatment may include dietary management, medications, or other interventions tailored to the specific disorder. Knowing the anticipated outcomes helps evaluate the importance of timely intervention.
Recommended video:
Guided course
03:52
Cell-cell interactions
Related Practice
Textbook Question

Select one of the hereditary conditions from either the RUSP core conditions list or the RUSP list of secondary conditions and do some online research to find the following information:

The defect that characterizes the condition.

398
views
Textbook Question

Select one of the hereditary conditions from either the RUSP core conditions list or the RUSP list of secondary conditions and do some online research to find the following information: The frequency of the condition in newborn infants (note any populations in which the condition is more frequent)

449
views
Textbook Question

Select one of the hereditary conditions from either the RUSP core conditions list or the RUSP list of secondary conditions and do some online research to find the following information:

The duration of treatment

580
views
Textbook Question

Select one of the hereditary conditions from either the RUSP core conditions list or the RUSP list of secondary conditions and do some online research to find the following information:

The recommended treatment for those with the condition.

446
views
Textbook Question

In the course of the Drosophila melanogaster genome project, the following genomic DNA sequences were obtained. Try to assemble the sequences into a single contig.

5' TTCCAGAACCGGCGAATGAAGCTGAAGAAG 3'

5' GAGCGGCAGATCAAGATCTGGTTCCAGAAC 3'

5' TGATCTGCCGCTCCGTCAGGCATAGCGCGT 3'

5' GGAGAATCGAGATGGCGCACGCGCTATGCC 3'

5' GGAGAATCGAGATGGCGCACGCGCTATGCC 3'

5' CCATCTCGATTCTCCGTCTGCGGGTCAGAT 3'

Go to the URL provided in Problem 14, and using the sequence you have just assembled, perform a blastn search in the 'Nucleotide collection (nr/nt)' database. Does the search produce sequences similar to your assembled sequence, and if so, what are they? Can you tell if your sequence is transcribed, and if it represents protein-coding sequence? Perform a tblastx search, first choosing the 'Nucleotide collection (nr/nt)' database and then limiting the search to human sequences by typing Homo sapiens in the organism box. Are homologous sequences found in the human genome? Annotate the assembled sequence.

486
views
Textbook Question

Consider the phylogenetic trees below pertaining to three related species (A, B, and C) that share a common ancestor (last common ancestor, or LCA). The lineage leading to species A diverges before the divergence of species B and C.

For gene X, no gene duplications have occurred in any lineage, and each gene X is derived from the ancestral gene X via speciation events. Are genes AX, BX, and CX orthologous, paralogous, or homologous?

388
views