Question 1

Which of the following best describes the structure of the DNA backbone in plant, human, and bacterial DNA?

Accepted Answer

The backbone is composed of alternating deoxyribose sugars and phosphate groups, and is structurally identical in all three organisms.

Question 2

Which of the following statements about base pairing in DNA is correct?

Accepted Answer

Adenine pairs with thymine via two hydrogen bonds, and cytosine pairs with guanine via three hydrogen bonds.

Question 3

A restriction enzyme cuts DNA at the sequence $$5'	ext{-}GAATTC	ext{-}3'$$ and $$3'	ext{-}CTTAAG	ext{-}5'. If a $$DNA molecule contains three such sites, how many fragments will result after complete digestion?

Accepted Answer

Four fragments

Question 4

EcoRI generates 'sticky ends' when it cuts DNA. What is meant by 'sticky ends'?

Accepted Answer

Single-stranded overhangs that can base pair with complementary sequences

Question 5

If you are using a p200 micropipette to measure 50 μl, which of the following is the correct way to set the dial?

Accepted Answer

Set the dial to 050

Question 6

A student is pipetting DNA samples and accidentally touches the tip to the side of the tube. What is the best practice?

Accepted Answer

Change the tip before continuing to avoid contamination.

Question 7

The restriction enzyme Alu I recognizes the sequence $$5'	ext{-}AGCT	ext{-}3'$$ and $$3'	ext{-}TCGA	ext{-}5'. If a $$DNA fragment contains two Alu I recognition sites, how many fragments will be produced after digestion?

Accepted Answer

Three fragments

Question 8

Which of the following best explains why EcoRI would not cut a DNA fragment that lacks the sequence $$5'	ext{-}GAATTC	ext{-}3'$$?

Accepted Answer

EcoRI is sequence-specific and only cuts at its recognition site.

Question 9

After performing a restriction digest with EcoRI, you observe two DNA fragments: one 6 base pairs long and one 12 base pairs long. If the original DNA was 18 base pairs, how many EcoRI sites were present?

Accepted Answer

One EcoRI site

Question 10

Which of the following is a key difference between the DNA fragments produced by Alu I and EcoRI?

Accepted Answer

Alu I produces blunt ends, while EcoRI produces sticky ends.

Question 11

A DNA sample is digested with Mbo I, which recognizes $$5'	ext{-}GATC	ext{-}3'. If $$the sequence contains four Mbo I sites, how many fragments will result?

Accepted Answer

Five fragments

Question 12

Why is it important to incubate the restriction digest at 37°C for 45 minutes?

Accepted Answer

Because 37°C is the optimal temperature for most restriction enzymes to function efficiently.

Question 13

Which of the following best explains why DNA fingerprinting can distinguish between individuals?

Accepted Answer

Individuals have unique linear sequences of base pairs in their DNA.

Question 14

If you mix 10 μl of DNA sample with 10 μl of enzyme mix, what is the total reaction volume?

Accepted Answer

$$20\ \mu l$$

Question 15

A student sets a p1000 pipette to 1000 μl but only needs to pipette 100 μl. What is the most likely outcome?

Accepted Answer

The student will pipette too much liquid, possibly overflowing the tip.

Question 16

Which of the following best describes the role of restriction endonucleases in recombinant DNA technology?

Accepted Answer

They cut DNA at specific sequences, allowing for the manipulation and analysis of DNA fragments.

Question 17

If a DNA fragment is cut by EcoRI and produces sticky ends, which enzyme would you use to join two compatible fragments together?

Accepted Answer

DNA ligase

Question 18

During a DNA fingerprinting experiment, why is it important to use a fresh pipette tip for each sample?

Accepted Answer

To prevent cross-contamination between samples.

Question 19

Which of the following is a correct statement about the use of restriction enzymes in DNA fingerprinting?

Accepted Answer

Adding the same restriction enzyme to different DNA samples can reveal differences in their base pair sequences.

Question 20

A DNA sequence is $$5'	ext{-}GATACGTCTGAGCTCGTTAACACTCTGCATTGCTGACGTTAACTGAGCTCAGGGATAG	ext{-}3'. $$How many times will Alu I (recognizing $$5'	ext{-}AGCT	ext{-}3') $$cut this sequence?

Accepted Answer

Two times

Bio 100 Lab 4 Chapter 4

Study Guide - Practice Questions

Study Guide - Flashcards