How would you clone a gene that you have identified by a mutant phenotype in Drosophila?

Traditional Sanger sequencing has largely been replaced in recent years by next-generation and third-generation sequencing approaches. Describe advantages of these sequencing methods over first-generation Sanger sequencing.

Given your knowledge of the genetic tools for studying Drosophila, outline a method by which you could clone the dunce and rutabaga genes identified by Seymour Benzer's laboratory in the genetic screen.

How is fluorescent in situ hybridization (FISH) used to produce a spectral karyotype?

You have generated three transgenic lines of maize that are resistant to the European corn borer, a significant pest in many regions of the world. The transgenic lines (T₁ in the accompanying table) were created using Agrobacterium-mediated transformation with a T-DNA having two genes, the first being a gene conferring resistance to the corn borer and the second being a gene conferring resistance to a herbicide that you used as a selectable marker to obtain your transgenic plants. You crossed each of the lines to a wild-type maize plant and also generated a T₂ population by self-fertilization of the T₁ plant. The following segregation results were observed (herbicide resistant : herbicide sensitive):

Explain these segregation ratios.

Bacterial Pseudomonas species often possess plasmids encoding genes involved in the catabolism of organic compounds. You have discovered a strain that can metabolize crude oil and wish to identify the gene(s) responsible. Outline an experimental protocol to find the gene or genes required for crude oil metabolism.

Microsatellites are currently exploited as markers for paternity testing. A sample paternity test is shown in the following table in which ten microsatellite markers were used to test samples from a mother, her child, and an alleged father. The name of the microsatellite locus is given in the left-hand column, and the genotype of each individual is recorded as the number of repeats he or she carries at that locus. For example, at locus D9S302, the mother carries 30 repeats on one of her chromosomes and 31 on the other. In cases where an individual carries the same number of repeats on both chromosomes, only a single number is recorded. (Some of the numbers are followed by a decimal point, for example, 20.2, to indicate a partial repeat in addition to the complete repeats.) Assuming that these markers are inherited in a simple Mendelian fashion, can the alleged father be excluded as the source of the sperm that produced the child? Why or why not? Explain.

Two complaints about some transgenic plants presently in commercial use are that (1) the Bt toxin gene is constitutively expressed in them, leading to fears that selection pressures will cause insects to evolve resistance to the toxin, and (2) a selectable marker gene—for example, conferring kanamycin resistance—remains in the plant, leading to concerns about increased antibiotic resistance in organisms in the wild. How would you generate transgenic plants that produce Bt only in response to being fed upon by insects and without the selectable marker?

The highlighted sequence shown below is the one originally used to produce the B chain of human insulin in E. coli. The sequence of the human gene encoding the B chain of insulin was later determined from a cDNA isolated from a human pancreatic cDNA library and is also shown below, without highlighting. Explain the differences between the two sequences.

ATGTTCGTCAATCAGCACCTTTGTGGTTCTCACCTCGTTGAAGCTTTGTACCTTGTTTGCGGTGAACGTGGTTTCTTCTACACTCCTAAGACTTAA

GCCTTTGTGAACCAACACCTGTGCGGCTCACACCTGGTGGAAGCTCTCTACCTAGTGTGCGGGGAACGAGGCTTCTTCTACACACCCAAGACCCGC