18. Molecular Genetic Tools

Genetic Cloning

18. Molecular Genetic Tools

Genetic Cloning

2:11 minutes

Problem 25

Textbook Question

Microsatellites are currently exploited as markers for paternity testing. A sample paternity test is shown in the following table in which ten microsatellite markers were used to test samples from a mother, her child, and an alleged father. The name of the microsatellite locus is given in the left-hand column, and the genotype of each individual is recorded as the number of repeats he or she carries at that locus. For example, at locus D9S302, the mother carries 30 repeats on one of her chromosomes and 31 on the other. In cases where an individual carries the same number of repeats on both chromosomes, only a single number is recorded. (Some of the numbers are followed by a decimal point, for example, 20.2, to indicate a partial repeat in addition to the complete repeats.) Assuming that these markers are inherited in a simple Mendelian fashion, can the alleged father be excluded as the source of the sperm that produced the child? Why or why not? Explain.

Verified step by step guidance

Step 1: Understand the inheritance pattern of microsatellite markers. Microsatellites are inherited in a Mendelian fashion, meaning that a child inherits one allele (number of repeats) from the mother and one allele from the father at each locus. This principle will guide the analysis of the data provided in the table.

Step 2: Compare the child's genotype at each microsatellite locus with the mother's genotype. Identify which allele (number of repeats) the child inherited from the mother. This will help determine which allele must have been inherited from the father.

Step 3: Compare the child's genotype with the alleged father's genotype at each locus. For each locus, check if the allele that the child did not inherit from the mother matches one of the alleged father's alleles. If there is a mismatch at any locus, the alleged father can be excluded as the biological father.

Step 4: Pay special attention to cases where the child has an allele that neither the mother nor the alleged father possesses. This would definitively exclude the alleged father as the biological father for that locus.

Step 5: Summarize the findings across all loci. If mismatches are found at multiple loci, the alleged father can be excluded with high confidence. If all loci match, the alleged father cannot be excluded based on the data provided.

Verified video answer for a similar problem:

This video solution was recommended by our tutors as helpful for the problem above

Video duration:

Was this helpful?

Key Concepts

Here are the essential concepts you must grasp in order to answer the question correctly.

Microsatellites

Microsatellites, also known as short tandem repeats (STRs), are repetitive sequences of DNA that consist of 1-6 base pairs repeated multiple times. They are highly polymorphic, meaning they vary greatly among individuals, making them useful for genetic profiling. In paternity testing, the number of repeats at specific loci can help determine genetic relationships, as children inherit one allele from each parent.

Mendelian Inheritance

Mendelian inheritance refers to the principles of genetic inheritance established by Gregor Mendel, which include the concepts of dominant and recessive alleles. In the context of microsatellites, it implies that alleles at a locus are inherited in a predictable manner, with one allele coming from each parent. This framework allows for the analysis of whether the alleged father can pass on the observed alleles in the child.

Paternity Testing

Paternity testing involves comparing the genetic markers of a child with those of the mother and the alleged father to determine biological relationships. By analyzing microsatellite loci, one can identify whether the alleged father shares the necessary alleles with the child. If the child possesses an allele that the alleged father does not have, he can be excluded as the biological father.

Watch next

Master Genetic Cloning with a bite sized video explanation from Kylia

Start learning

Related Videos

Related Practice

Textbook Question

How is fluorescent in situ hybridization (FISH) used to produce a spectral karyotype?

720

views

Textbook Question

You have generated three transgenic lines of maize that are resistant to the European corn borer, a significant pest in many regions of the world. The transgenic lines (T₁ in the accompanying table) were created using Agrobacterium-mediated transformation with a T-DNA having two genes, the first being a gene conferring resistance to the corn borer and the second being a gene conferring resistance to a herbicide that you used as a selectable marker to obtain your transgenic plants. You crossed each of the lines to a wild-type maize plant and also generated a T₂ population by self-fertilization of the T₁ plant. The following segregation results were observed (herbicide resistant : herbicide sensitive):

Explain these segregation ratios.

493

views

Textbook Question

How would you clone a gene that you have identified by a mutant phenotype in Drosophila?

663

views

Textbook Question

Bacterial Pseudomonas species often possess plasmids encoding genes involved in the catabolism of organic compounds. You have discovered a strain that can metabolize crude oil and wish to identify the gene(s) responsible. Outline an experimental protocol to find the gene or genes required for crude oil metabolism.

452

views

Textbook Question

Two complaints about some transgenic plants presently in commercial use are that (1) the Bt toxin gene is constitutively expressed in them, leading to fears that selection pressures will cause insects to evolve resistance to the toxin, and (2) a selectable marker gene—for example, conferring kanamycin resistance—remains in the plant, leading to concerns about increased antibiotic resistance in organisms in the wild. How would you generate transgenic plants that produce Bt only in response to being fed upon by insects and without the selectable marker?

365

views

Textbook Question

The highlighted sequence shown below is the one originally used to produce the B chain of human insulin in E. coli. The sequence of the human gene encoding the B chain of insulin was later determined from a cDNA isolated from a human pancreatic cDNA library and is also shown below, without highlighting. Explain the differences between the two sequences.

ATGTTCGTCAATCAGCACCTTTGTGGTTCTCACCTCGTTGAAGCTTTGTACCTTGTTTGCGGTGAACGTGGTTTCTTCTACACTCCTAAGACTTAA

GCCTTTGTGAACCAACACCTGTGCGGCTCACACCTGGTGGAAGCTCTCTACCTAGTGTGCGGGGAACGAGGCTTCTTCTACACACCCAAGACCCGC

581

views

Textbook Question

The CRISPR-Cas system has great potential but also raises many ethical issues about its potential applications because, theoretically, it can be used to edit any gene in the genome. What do you think are some of the concerns about the use of CRISPR-Cas on humans? Should CRISPR-Cas applications be limited for use on only certain human genes but not others? Explain your answers.

572

views

Textbook Question

Vitamin E is the name for a set of chemically related tocopherols, which are lipid-soluble compounds with antioxidant properties. Such antioxidants protect cells against the effects of free radicals created as by-products of energy metabolism in the mitochondrion. Different tocopherols have different biological activities due to differences in their retention by binding to gut proteins during digestion. The one retained at the highest level is α-tocopherol, whereas γ-tocopherol is retained at less than 10% of that efficiency. In Arabidopsis, α-tocopherol is the most abundant tocopherol in leaves, whereas γ-tocopherol is the most abundant in seeds. An enzyme encoded by the VTE4 gene can convert γ-tocopherol to α-tocopherol. How would you create an Arabidopsis plant that produces high levels of α-tocopherol in the seeds?

446

views

Show more practices