Question 1

Which of the following statements best describes the degeneracy of the genetic code?

Accepted Answer

Some amino acids are specified by more than one codon.

Question 2

A mutation changes the DNA codon GAG (which codes for Glu) to GTG (which codes for Val) in the β-globin gene. What disease is most directly associated with this mutation?

Accepted Answer

Sickle-cell anemia

Question 3

Which codon serves as the universal start codon for translation in both prokaryotes and eukaryotes?

Accepted Answer

$$\mathrm{AUG}$$

Question 4

According to the wobble hypothesis, which of the following anticodons could pair with both $$\mathrm{UUC}$$ and $$\mathrm{UUU}$$ codons for phenylalanine?

Accepted Answer

$$\mathrm{AAG}$$

Question 5

Which of the following best explains why the genetic code is described as 'non-overlapping'?

Accepted Answer

Each nucleotide is part of only one codon.

Question 6

A scientist sequences an mRNA strand: $$5'	ext{-}CUAUGUGUCGUAACAGCCGAUGACCCG	ext{-}3'. $$What is the correct amino acid sequence produced from this mRNA?

Accepted Answer

Met-Cys-Val-Thr-Ala-Asp-Pro

Question 7

Which of the following is NOT a function of the ribosome during translation?

Accepted Answer

Synthesizing tRNA molecules

Question 8

In prokaryotes, what sequence on the mRNA helps the ribosome identify the correct start site for translation?

Accepted Answer

Shine-Dalgarno sequence

Question 9

Which enzyme is responsible for attaching the correct amino acid to its corresponding tRNA?

Accepted Answer

Aminoacyl-tRNA synthetase

Question 10

Which of the following codons is a stop codon in the standard genetic code?

Accepted Answer

$$\mathrm{UAA}$$

Question 11

What is the main reason why a triplet code (three nucleotides per codon) is necessary to encode all 20 amino acids?

Accepted Answer

A triplet code provides $$4^3 = 64$ possible codons, which is more than enough for 20 amino acids.

Question 12

Which of the following best describes the role of the anticodon loop of tRNA?

Accepted Answer

It base-pairs with the complementary codon on mRNA.

Question 13

During translation elongation, which site on the ribosome does the incoming aminoacyl-tRNA first bind?

Accepted Answer

A site (Aminoacyl-tRNA site)

Question 14

Which of the following statements about translation in prokaryotes is TRUE?

Accepted Answer

Translation can begin before transcription is complete.

Question 15

Which of the following is a direct consequence of a nonsense mutation in a coding region?

Accepted Answer

Premature termination of translation

Question 16

Which of the following best explains why the genetic code is considered 'nearly universal'?

Accepted Answer

Most organisms use the same codons to specify the same amino acids.

Question 17

Which of the following is the correct sequence of events during translation initiation in eukaryotes?

Accepted Answer

Small ribosomal subunit binds the 5' cap, scans for AUG, then large subunit joins

Question 18

Which of the following best describes the function of peptidyl transferase during translation?

Accepted Answer

It catalyzes the formation of peptide bonds between amino acids.

Question 19

A mutation in the third base of a codon often does not change the amino acid specified. This phenomenon is best explained by:

Accepted Answer

The wobble hypothesis

Question 20

Which of the following is NOT required for the process of translation?

Accepted Answer

DNA polymerase

The Genetic Code and Translation: Structure, Function, and Mechanisms

Study Guide - Practice Questions

Study Guide - Flashcards