Multiple Choice
Which of the following polypeptide chains are synthesized from the RNA sequence:
5' – AUGAUCCGAAGUGGCACAGCAUAA - 3'
2182
views
14
rank
15. Gene Expression
Review of Transcription vs. Translation
Back15. Gene Expression
Review of Transcription vs. Translation
- Multiple ChoiceAt one point, as a cell carried out its day-to-day activities, the nucleotides GAT were paired with the nucleotides CUA. This pairing occurred __________.1290views
- Multiple ChoiceWhich summary of protein synthesis is correct?1726views
- Multiple ChoiceWhat is their proper sequence for these steps?
1. translation
2. RNA processing
3. transcription
4. modification of protein1494views - Multiple ChoicePolysomes may be defined as __________.1090views
- Textbook QuestionThe primary cause of death from αα-amanitin poisoning is liver failure. Suppose a physician informs you that liver cells die because their rate of protein production falls below a level needed to maintain active metabolism. Given that αα-amanitin is an inhibitor of transcription, you wonder if this information is correct. Propose an experiment to determine whether the toxin also has an effect on protein synthesis.797views
- Textbook Question
<Image>
Eating even a single death cap mushroom (Amanita phalloides) can be fatal due to a compound called α-amanitin, a toxin that inhibits transcription.
The primary cause of death from α-amanitin poisoning is liver failure. Suppose a physician informs you that liver cells die because their rate of protein production falls below a level needed to maintain active metabolism. Given that α-amanitin is an inhibitor of transcription, you wonder if this information is correct. Propose an experiment to determine whether the toxin also has an effect on protein synthesis.
449views