15. Genomes and Genomics

Bioinformatics

15. Genomes and Genomics

Bioinformatics

2:29 minutes

Problem 26b

Textbook Question

DNA footprint protection is a method that determines whether proteins bind to a specific sample of DNA and thus protect part of the DNA from random enzymatic cleavage by DNase I. A 400-bp segment of cloned DNA is thought to contain a promoter. The cloned DNA is analyzed by DNA footprinting to help determine if it has the capacity to act as a promoter sequence. The accompanying gel has two lanes, each containing the cloned 400-bp DNA fragment treated with DNase I to randomly cleave unprotected DNA. Lane 1 is cloned DNA that was mixed with RNA polymerase II and several TFII transcription factors before exposure to DNase I. Lane 2 contains cloned DNA that was exposed only to DNase I. RNA pol II and TFIIs were not mixed with that DNA before adding DNase I. Approximately what length is the DNA region protected by RNA pol II and TFIIs?

Verified step by step guidance

Understand the concept of DNA footprinting: DNA footprinting is a technique used to identify the specific region of DNA that is bound by a protein. When a protein binds to DNA, it protects that region from enzymatic cleavage by DNase I. By comparing the cleavage patterns of DNA with and without the protein, the protected region can be identified.

Examine the gel lanes: Lane 1 represents the DNA treated with RNA polymerase II and TFII transcription factors before DNase I cleavage. Lane 2 represents the DNA treated only with DNase I. The protected region will appear as a gap or absence of bands in Lane 1 compared to Lane 2, as the protein binding prevents DNase I from cleaving the DNA in that region.

Measure the protected region: To determine the length of the protected DNA region, compare the position of the gap in Lane 1 to the DNA ladder or size markers (if provided) on the gel. The size markers indicate the length of DNA fragments in base pairs (bp). The difference in fragment sizes between the start and end of the gap corresponds to the length of the protected region.

Account for the experimental setup: The DNA fragment used in this experiment is 400 bp long. The protected region will be a subset of this 400 bp fragment. Ensure that the gap in Lane 1 is consistent with the expected binding of RNA polymerase II and TFII transcription factors to the promoter region.

Estimate the length of the protected region: Based on the gel analysis, calculate the approximate size of the protected region by subtracting the size of the smaller fragment at the end of the gap from the size of the larger fragment at the start of the gap. This difference represents the length of the DNA region protected by RNA polymerase II and TFII transcription factors.

Verified video answer for a similar problem:

This video solution was recommended by our tutors as helpful for the problem above

Video duration:

Was this helpful?

Key Concepts

Here are the essential concepts you must grasp in order to answer the question correctly.

DNA Footprinting

DNA footprinting is a technique used to identify the specific regions of DNA that are bound by proteins, such as transcription factors or RNA polymerase. When DNA is treated with DNase I, it cleaves unprotected regions, leaving a 'footprint' of protected areas where proteins are bound. This method allows researchers to visualize and analyze the binding sites of proteins on DNA, providing insights into gene regulation.

Transcription Factors and RNA Polymerase II

Transcription factors are proteins that bind to specific DNA sequences to regulate gene expression, often by recruiting RNA polymerase II, the enzyme responsible for synthesizing RNA from a DNA template. In the context of the experiment, RNA polymerase II and transcription factors (TFIIs) work together to initiate transcription at promoter regions, which are crucial for gene expression. Their binding can protect certain DNA regions from cleavage by DNase I.

Gel Electrophoresis

Gel electrophoresis is a laboratory technique used to separate DNA fragments based on their size. In the context of DNA footprinting, after DNase I treatment, the resulting DNA fragments are loaded onto a gel, and an electric current is applied. Smaller fragments move faster through the gel matrix, allowing researchers to visualize the protected regions as bands, which indicate where proteins have bound and prevented cleavage.

Watch next

Master Bioinformatics with a bite sized video explanation from Kylia

Start learning

Related Videos

Related Practice

Textbook Question

Do you think it is important that participation in community-based genetic screening be entirely voluntary? Why or why not?

425

views

Textbook Question

BLAST searches and related applications are essential for analyzing gene and protein sequences. Define BLAST, describe basic features of this bioinformatics tool, and give an example of information provided by a BLAST search.

946

views

Textbook Question

Go to http://blast.ncbi.nlm.nih.gov/Blast.cgi and follow the links to nucleotide BLAST. Type in the sequence below; it is broken up into codons to make it easier to copy.

5' ATG TTC GTC AAT CAG CAC CTT TGT GGT TCT CAC CTC GTT GAA GCTTTG TAC CTT GTT TGC GGT GAA CGT GGT TTC TTC TAC ACT CCT AAG ACT TAA 3'

As you will note on the BLAST page, there are several options for tailoring your query to obtain the most relevant information. Some are related to which sequences to search in the database. For example, the search can be limited taxonomically (e.g., restricted to mammals) or by the type of sequences in the database (e.g., cDNA or genomic). For our search, we will use the broadest database, the 'Nucleotide collection (nr/nt).' This is the nonredundant (nr) database of all nucleotide data (nt) in GenBank and can be selected in the 'Database' dialogue box. Other parameters can also be adjusted to make the search more or less sensitive to mismatches or gaps. For our purposes, we will use the default setting, which is automatically presented. Press 'BLAST' to search. What can you say about the DNA sequence?

340

views

Textbook Question

In the course of the Drosophila melanogaster genome project, the following genomic DNA sequences were obtained. Try to assemble the sequences into a single contig.

5' TTCCAGAACCGGCGAATGAAGCTGAAGAAG 3'

5' GAGCGGCAGATCAAGATCTGGTTCCAGAAC 3'

5' TGATCTGCCGCTCCGTCAGGCATAGCGCGT 3'

5' GGAGAATCGAGATGGCGCACGCGCTATGCC 3'

5' CCATCTCGATTCTCCGTCTGCGGGTCAGAT 3'

Go to the URL provided in Problem 14, and using the sequence you have just assembled, perform a blastn search in the 'Nucleotide collection (nr/nt)' database. Does the search produce sequences similar to your assembled sequence, and if so, what are they? Can you tell if your sequence is transcribed, and if it represents protein-coding sequence? Perform a tblastx search, first choosing the 'Nucleotide collection (nr/nt)' database and then limiting the search to human sequences by typing Homo sapiens in the organism box. Are homologous sequences found in the human genome? Annotate the assembled sequence.

422

views

Textbook Question

DNA footprint protection is a method that determines whether proteins bind to a specific sample of DNA and thus protect part of the DNA from random enzymatic cleavage by DNase I. A 400-bp segment of cloned DNA is thought to contain a promoter. The cloned DNA is analyzed by DNA footprinting to help determine if it has the capacity to act as a promoter sequence. The accompanying gel has two lanes, each containing the cloned 400-bp DNA fragment treated with DNase I to randomly cleave unprotected DNA. Lane 1 is cloned DNA that was mixed with RNA polymerase II and several TFII transcription factors before exposure to DNase I. Lane 2 contains cloned DNA that was exposed only to DNase I. RNA pol II and TFIIs were not mixed with that DNA before adding DNase I. What additional genetic experiments would you suggest to verify that this region of cloned DNA contains a functional promoter?

602

views

Textbook Question

DNA footprint protection is a method that determines whether proteins bind to a specific sample of DNA and thus protect part of the DNA from random enzymatic cleavage by DNase I. A 400-bp segment of cloned DNA is thought to contain a promoter. The cloned DNA is analyzed by DNA footprinting to help determine if it has the capacity to act as a promoter sequence. The accompanying gel has two lanes, each containing the cloned 400-bp DNA fragment treated with DNase I to randomly cleave unprotected DNA. Lane 1 is cloned DNA that was mixed with RNA polymerase II and several TFII transcription factors before exposure to DNase I. Lane 2 contains cloned DNA that was exposed only to DNase I. RNA pol II and TFIIs were not mixed with that DNA before adding DNase I. Explain why this gel provides evidence that the cloned DNA may act as a promoter sequence.

703

views

Multiple Choice

Bioinformatics includes all of the following except:

views

Multiple Choice

Which of the following is NOT a piece of information that bioinformatics can analyze?