Skip to main content
Ch. 16 - Genomics: Genetics from a Whole-Genome Perspective
Sanders - Genetic Analysis: An Integrated Approach 3rd Edition
Sanders3rd EditionGenetic Analysis: An Integrated ApproachISBN: 9780135564172Not the one you use?Change textbook
Chapter 16, Problem 15

In the course of the Drosophila melanogaster genome project, the following genomic DNA sequences were obtained. Try to assemble the sequences into a single contig.
5' TTCCAGAACCGGCGAATGAAGCTGAAGAAG 3'
5' GAGCGGCAGATCAAGATCTGGTTCCAGAAC 3'
5' TGATCTGCCGCTCCGTCAGGCATAGCGCGT 3'
5' GGAGAATCGAGATGGCGCACGCGCTATGCC 3'
5' GGAGAATCGAGATGGCGCACGCGCTATGCC 3'
5' CCATCTCGATTCTCCGTCTGCGGGTCAGAT 3'
Go to the URL provided in Problem 14, and using the sequence you have just assembled, perform a blastn search in the 'Nucleotide collection (nr/nt)' database. Does the search produce sequences similar to your assembled sequence, and if so, what are they? Can you tell if your sequence is transcribed, and if it represents protein-coding sequence? Perform a tblastx search, first choosing the 'Nucleotide collection (nr/nt)' database and then limiting the search to human sequences by typing Homo sapiens in the organism box. Are homologous sequences found in the human genome? Annotate the assembled sequence.

Verified step by step guidance
1
Begin by examining each provided DNA sequence carefully, noting their 5' to 3' orientation. Since these are genomic fragments, your goal is to find overlapping regions between the sequences to assemble them into a continuous stretch, called a contig.
Compare the end of one sequence with the beginning of another to identify overlaps. For example, look for a substring at the 3' end of one sequence that matches the 5' start of another sequence. This overlap indicates that these sequences are adjacent in the genome.
Once you identify overlapping sequences, merge them by aligning the overlapping regions, ensuring that the overlapping nucleotides match perfectly. Continue this process iteratively, joining sequences step-by-step until all sequences are assembled into a single contig.
After assembling the contig, use the assembled sequence to perform a blastn search against the 'Nucleotide collection (nr/nt)' database. This will help you find similar sequences and determine if your assembled sequence corresponds to known genomic regions, genes, or other elements.
Next, perform a tblastx search with your assembled sequence, first against the entire nucleotide database and then limiting the search to Homo sapiens sequences. This will translate your nucleotide sequence in all six reading frames and compare it to protein sequences, helping you identify potential protein-coding regions and homologous sequences in humans. Use these results to annotate your assembled sequence, indicating whether it is transcribed and if it likely encodes a protein.

Verified video answer for a similar problem:

This video solution was recommended by our tutors as helpful for the problem above.
Video duration:
2m
Was this helpful?

Key Concepts

Here are the essential concepts you must grasp in order to answer the question correctly.

Sequence Assembly and Contig Formation

Sequence assembly involves aligning and merging overlapping DNA fragments to reconstruct the original sequence, forming a continuous stretch called a contig. Understanding how to identify overlaps and correctly order sequences is essential for genome projects and accurate downstream analysis.
Recommended video:
Guided course
08:41
Sequencing Difficulties

BLAST Searches and Sequence Similarity

BLAST (Basic Local Alignment Search Tool) compares a query sequence against databases to find regions of similarity, indicating homology or functional relationships. Different BLAST programs (blastn, tblastx) serve specific purposes, such as nucleotide-nucleotide or translated nucleotide searches, helping identify related sequences and infer function.
Recommended video:
Guided course
08:41
Sequencing Difficulties

Gene Annotation and Functional Inference

Gene annotation involves identifying features like coding regions, transcriptional activity, and homologous genes within a sequence. By analyzing BLAST results and sequence characteristics, one can determine if a sequence is transcribed, protein-coding, and conserved across species, providing insights into its biological role.
Recommended video:
Guided course
08:26
Functional Genomics
Related Practice
Textbook Question

Select one of the hereditary conditions from either the RUSP core conditions list or the RUSP list of secondary conditions and do some online research to find the following information:

The recommended treatment for those with the condition.

447
views
Textbook Question

Consider the phylogenetic trees below pertaining to three related species (A, B, and C) that share a common ancestor (last common ancestor, or LCA). The lineage leading to species A diverges before the divergence of species B and C.

For gene X, no gene duplications have occurred in any lineage, and each gene X is derived from the ancestral gene X via speciation events. Are genes AX, BX, and CX orthologous, paralogous, or homologous?

392
views
Textbook Question

Select one of the hereditary conditions from either the RUSP core conditions list or the RUSP list of secondary conditions and do some online research to find the following information:

The duration of treatment

582
views
Textbook Question

Consider the phylogenetic trees below pertaining to three related species (A, B, and C) that share a common ancestor (last common ancestor, or LCA). The lineage leading to species A diverges before the divergence of species B and C.

For gene Y, a gene duplication occurred in the lineage leading to A after it diverged from that, leading to B and C. Are genes AY1 and AY2 orthologous or paralogous? Are genes AY1 and BY orthologous or paralogous? Are genes BY and CY orthologous or paralogous?

438
views
Textbook Question

Select one of the hereditary conditions from either the RUSP core conditions list or the RUSP list of secondary conditions and do some online research to find the following information:

The anticipated outcome if treatment is applied

511
views
Textbook Question

Consider the phylogenetic trees below pertaining to three related species (A, B, and C) that share a common ancestor (last common ancestor, or LCA). The lineage leading to species A diverges before the divergence of species B and C.

For gene Z, gene duplications have occurred in all species. Define orthology and paralogy relationships for the different Z genes.

381
views