15. Genomes and Genomics

Bioinformatics

15. Genomes and Genomics

Bioinformatics

3:09 minutes

Problem 26c

Textbook Question

DNA footprint protection is a method that determines whether proteins bind to a specific sample of DNA and thus protect part of the DNA from random enzymatic cleavage by DNase I. A 400-bp segment of cloned DNA is thought to contain a promoter. The cloned DNA is analyzed by DNA footprinting to help determine if it has the capacity to act as a promoter sequence. The accompanying gel has two lanes, each containing the cloned 400-bp DNA fragment treated with DNase I to randomly cleave unprotected DNA. Lane 1 is cloned DNA that was mixed with RNA polymerase II and several TFII transcription factors before exposure to DNase I. Lane 2 contains cloned DNA that was exposed only to DNase I. RNA pol II and TFIIs were not mixed with that DNA before adding DNase I. What additional genetic experiments would you suggest to verify that this region of cloned DNA contains a functional promoter?

Verified step by step guidance

Step 1: Perform a reporter gene assay. Clone the 400-bp DNA segment upstream of a reporter gene (e.g., luciferase or GFP) in a plasmid vector. Introduce this plasmid into a suitable host cell and measure the expression of the reporter gene. If the DNA segment contains a functional promoter, it will drive the expression of the reporter gene, resulting in detectable activity (e.g., fluorescence or luminescence).

Step 2: Conduct a mutational analysis. Introduce specific mutations or deletions into the 400-bp DNA segment to identify critical regions required for promoter activity. Test the mutated sequences using the reporter gene assay to determine how the mutations affect gene expression.

Step 3: Perform an electrophoretic mobility shift assay (EMSA). Use labeled DNA fragments from the 400-bp region and mix them with nuclear extracts or purified transcription factors. If the DNA contains a functional promoter, specific protein-DNA complexes will form, causing a shift in the mobility of the DNA during gel electrophoresis.

Step 4: Test for transcription initiation in vitro. Use an in vitro transcription assay with the 400-bp DNA segment as a template. Add RNA polymerase II and necessary transcription factors to the reaction and analyze the RNA products to confirm whether transcription is initiated from this DNA region.

Step 5: Analyze chromatin accessibility using DNase I hypersensitivity or ATAC-seq. Functional promoters are often located in regions of open chromatin. Test whether the 400-bp DNA segment is in an accessible chromatin state, which would support its role as a promoter.

Verified video answer for a similar problem:

This video solution was recommended by our tutors as helpful for the problem above

Video duration:

Was this helpful?

Key Concepts

Here are the essential concepts you must grasp in order to answer the question correctly.

DNA Footprinting

DNA footprinting is a technique used to identify the specific regions of DNA that are bound by proteins, such as transcription factors. By treating DNA with DNase I, which cleaves unprotected DNA, researchers can visualize the protected regions on a gel. This method helps determine the binding sites of proteins and can indicate the presence of functional elements like promoters.

Promoter Functionality

A promoter is a DNA sequence that initiates transcription of a gene by providing a binding site for RNA polymerase and transcription factors. To verify a region's functionality as a promoter, experiments can assess its ability to drive gene expression in a cellular context, often using reporter assays that measure the activity of a reporter gene linked to the promoter of interest.

Transcription Factors and RNA Polymerase II

Transcription factors are proteins that bind to specific DNA sequences to regulate gene expression, often working in conjunction with RNA polymerase II, which synthesizes mRNA from DNA. The presence of these factors is crucial for the activation of promoters. Experiments that manipulate the levels or activity of these factors can help confirm whether a DNA region functions as a promoter by observing changes in transcription levels.

Watch next

Master Bioinformatics with a bite sized video explanation from Kylia

Start learning

Related Videos

Related Practice

Textbook Question

BLAST searches and related applications are essential for analyzing gene and protein sequences. Define BLAST, describe basic features of this bioinformatics tool, and give an example of information provided by a BLAST search.

946

views

Textbook Question

Go to http://blast.ncbi.nlm.nih.gov/Blast.cgi and follow the links to nucleotide BLAST. Type in the sequence below; it is broken up into codons to make it easier to copy.

5' ATG TTC GTC AAT CAG CAC CTT TGT GGT TCT CAC CTC GTT GAA GCTTTG TAC CTT GTT TGC GGT GAA CGT GGT TTC TTC TAC ACT CCT AAG ACT TAA 3'

As you will note on the BLAST page, there are several options for tailoring your query to obtain the most relevant information. Some are related to which sequences to search in the database. For example, the search can be limited taxonomically (e.g., restricted to mammals) or by the type of sequences in the database (e.g., cDNA or genomic). For our search, we will use the broadest database, the 'Nucleotide collection (nr/nt).' This is the nonredundant (nr) database of all nucleotide data (nt) in GenBank and can be selected in the 'Database' dialogue box. Other parameters can also be adjusted to make the search more or less sensitive to mismatches or gaps. For our purposes, we will use the default setting, which is automatically presented. Press 'BLAST' to search. What can you say about the DNA sequence?

340

views

Textbook Question

In the course of the Drosophila melanogaster genome project, the following genomic DNA sequences were obtained. Try to assemble the sequences into a single contig.

5' TTCCAGAACCGGCGAATGAAGCTGAAGAAG 3'

5' GAGCGGCAGATCAAGATCTGGTTCCAGAAC 3'

5' TGATCTGCCGCTCCGTCAGGCATAGCGCGT 3'

5' GGAGAATCGAGATGGCGCACGCGCTATGCC 3'

5' CCATCTCGATTCTCCGTCTGCGGGTCAGAT 3'

Go to the URL provided in Problem 14, and using the sequence you have just assembled, perform a blastn search in the 'Nucleotide collection (nr/nt)' database. Does the search produce sequences similar to your assembled sequence, and if so, what are they? Can you tell if your sequence is transcribed, and if it represents protein-coding sequence? Perform a tblastx search, first choosing the 'Nucleotide collection (nr/nt)' database and then limiting the search to human sequences by typing Homo sapiens in the organism box. Are homologous sequences found in the human genome? Annotate the assembled sequence.

422

views

Textbook Question

DNA footprint protection is a method that determines whether proteins bind to a specific sample of DNA and thus protect part of the DNA from random enzymatic cleavage by DNase I. A 400-bp segment of cloned DNA is thought to contain a promoter. The cloned DNA is analyzed by DNA footprinting to help determine if it has the capacity to act as a promoter sequence. The accompanying gel has two lanes, each containing the cloned 400-bp DNA fragment treated with DNase I to randomly cleave unprotected DNA. Lane 1 is cloned DNA that was mixed with RNA polymerase II and several TFII transcription factors before exposure to DNase I. Lane 2 contains cloned DNA that was exposed only to DNase I. RNA pol II and TFIIs were not mixed with that DNA before adding DNase I. Approximately what length is the DNA region protected by RNA pol II and TFIIs?

632

views

Textbook Question

DNA footprint protection is a method that determines whether proteins bind to a specific sample of DNA and thus protect part of the DNA from random enzymatic cleavage by DNase I. A 400-bp segment of cloned DNA is thought to contain a promoter. The cloned DNA is analyzed by DNA footprinting to help determine if it has the capacity to act as a promoter sequence. The accompanying gel has two lanes, each containing the cloned 400-bp DNA fragment treated with DNase I to randomly cleave unprotected DNA. Lane 1 is cloned DNA that was mixed with RNA polymerase II and several TFII transcription factors before exposure to DNase I. Lane 2 contains cloned DNA that was exposed only to DNase I. RNA pol II and TFIIs were not mixed with that DNA before adding DNase I. Explain why this gel provides evidence that the cloned DNA may act as a promoter sequence.

703

views

Multiple Choice

Bioinformatics includes all of the following except:

views

Multiple Choice

Which of the following is NOT a piece of information that bioinformatics can analyze?

Which of the following can be used to identify an open-reading frame?