Microsatellites are currently exploited as markers for paternity testing. A sample paternity test is shown in the following table in which ten microsatellite markers were used to test samples from a mother, her child, and an alleged father. The name of the microsatellite locus is given in the left-hand column, and the genotype of each individual is recorded as the number of repeats he or she carries at that locus. For example, at locus D9S302, the mother carries 30 repeats on one of her chromosomes and 31 on the other. In cases where an individual carries the same number of repeats on both chromosomes, only a single number is recorded. (Some of the numbers are followed by a decimal point, for example, 20.2, to indicate a partial repeat in addition to the complete repeats.) Assuming that these markers are inherited in a simple Mendelian fashion, can the alleged father be excluded as the source of the sperm that produced the child? Why or why not? Explain.
18. Molecular Genetic Tools
Genetic Cloning
- Textbook Question872views
- Textbook Question
Two complaints about some transgenic plants presently in commercial use are that (1) the Bt toxin gene is constitutively expressed in them, leading to fears that selection pressures will cause insects to evolve resistance to the toxin, and (2) a selectable marker gene—for example, conferring kanamycin resistance—remains in the plant, leading to concerns about increased antibiotic resistance in organisms in the wild. How would you generate transgenic plants that produce Bt only in response to being fed upon by insects and without the selectable marker?
366views - Textbook Question
The highlighted sequence shown below is the one originally used to produce the B chain of human insulin in E. coli. The sequence of the human gene encoding the B chain of insulin was later determined from a cDNA isolated from a human pancreatic cDNA library and is also shown below, without highlighting. Explain the differences between the two sequences.
ATGTTCGTCAATCAGCACCTTTGTGGTTCTCACCTCGTTGAAGCTTTGTACCTTGTTTGCGGTGAACGTGGTTTCTTCTACACTCCTAAGACTTAA
GCCTTTGTGAACCAACACCTGTGCGGCTCACACCTGGTGGAAGCTCTCTACCTAGTGTGCGGGGAACGAGGCTTCTTCTACACACCCAAGACCCGC582views - Textbook Question
The CRISPR-Cas system has great potential but also raises many ethical issues about its potential applications because, theoretically, it can be used to edit any gene in the genome. What do you think are some of the concerns about the use of CRISPR-Cas on humans? Should CRISPR-Cas applications be limited for use on only certain human genes but not others? Explain your answers.
575views - Textbook Question
Vitamin E is the name for a set of chemically related tocopherols, which are lipid-soluble compounds with antioxidant properties. Such antioxidants protect cells against the effects of free radicals created as by-products of energy metabolism in the mitochondrion. Different tocopherols have different biological activities due to differences in their retention by binding to gut proteins during digestion. The one retained at the highest level is α-tocopherol, whereas γ-tocopherol is retained at less than 10% of that efficiency. In Arabidopsis, α-tocopherol is the most abundant tocopherol in leaves, whereas γ-tocopherol is the most abundant in seeds. An enzyme encoded by the VTE4 gene can convert γ-tocopherol to α-tocopherol. How would you create an Arabidopsis plant that produces high levels of α-tocopherol in the seeds?
447views - Textbook Question
The gel presented here shows the pattern of bands of fragments produced with several restriction enzymes. The enzymes used are identified above the lanes of the gel, and six possible restriction maps are shown in the column to the right.
One of the six restriction maps shown is consistent with the pattern of bands shown in the gel.
The highlighted bands (magenta) in the gel were hybridized with a probe for the gene pep during a Southern blot. Where in the gel is the pep gene located?
654views - Textbook Question
The gel presented here shows the pattern of bands of fragments produced with several restriction enzymes. The enzymes used are identified above the lanes of the gel, and six possible restriction maps are shown in the column to the right.
One of the six restriction maps shown is consistent with the pattern of bands shown in the gel.
From your analysis of the pattern of bands on the gel, select the correct restriction map and explain your reasoning.
544views - Textbook Question
The RAS gene encodes a signaling protein that hydrolyzes GTP to GDP. When bound by GDP, the RAS protein is inactive, whereas when bound by GTP, RAS protein activates a target protein, resulting in stimulation of cells to actively grow and divide. As shown in the accompanying sequence, a single base-pair mutation results in a mutant protein that is constitutively active, leading to continual promotion of cell proliferation. Such mutations play a role in the formation of cancer. You have cloned the wild-type version of the mouse RAS gene and wish to create a mutant form to study its biological activity in vitro and in transgenic mice. Outline how you would proceed.
713views - Textbook Question
A widely used method for calculating the annealing temperature for a primer used in PCR is 5 degrees below the melting temperature, Tₘ(°C), which is computed by the equation 81.5+0.41×(%GC)−(675/N), where %GC is the percentage of GC nucleotides in the oligonucleotide and N is the length of the oligonucleotide. Notice from the formula that both the GC content and the length of the oligonucleotide are variables. Assuming you have the following oligonucleotide as a primer,
5′-TTGAAAATATTTCCCATTGCC-3′
Compute the annealing temperature for PCR. What is the relationship between %GC and? Why? (Note: In reality, this computation provides only a starting point for empirical determination of the most useful annealing temperature.)
907views - Textbook Question
You have cloned a gene for an enzyme that degrades lipids in a bacterium that normally lives in cold temperatures. You wish to transfer this gene into E. coli to produce industrial amounts of enzyme for use in laundry detergent.
You have managed to produce transgenic E. coli expressing mRNA of your gene, but only a low level of protein is produced. Why might this be so? How could you overcome this problem?
474views - Textbook Question
You have cloned a gene for an enzyme that degrades lipids in a bacterium that normally lives in cold temperatures. You wish to transfer this gene into E. coli to produce industrial amounts of enzyme for use in laundry detergent.
How would you accomplish this?
438views - Textbook Question
Most of the techniques described in this chapter (blotting, cloning, PCR, etc.) are dependent on hybridization (annealing) between different populations of nucleic acids. The length of the strands, temperature, and percentage of GC nucleotides weigh considerably on hybridization. Two other components commonly used in hybridization protocols are monovalent ions and formamide. A formula that takes monovalent Na⁺ ions (M[Na⁺]) and formamide concentrations into consideration to compute a Tₘ (temperature of melting) is as follows:
Tₘ=81.5+16.6(log M[Na+])+0.41(%GC)−0.72(%formamide)
Given that formamide competes for hydrogen bond locations on nucleic acid bases and monovalent cations are attracted to the negative charges on nucleic acids, explain why the Tₘ varies as described in part (a).
381views - Textbook Question
Most of the techniques (blotting, cloning, PCR, etc.) are dependent on hybridization (annealing) between different populations of nucleic acids. The length of the strands, temperature, and percentage of GC nucleotides weigh considerably on hybridization. Two other components commonly used in hybridization protocols are monovalent ions and formamide. A formula that takes monovalent Na⁺ ions (M[Na⁺]) and formamide concentrations into consideration to compute a Tₘ (temperature of melting) is as follows:
Tₘ=81.5+16.6(log M[Na+])+0.41(%GC)−0.72(%formamide)
For the following concentrations of Na⁺ and formamide, calculate the Tₘ. Assume 45% GC content.
[Na⁺] % Formamide
0.825 20
0.825 40
0.165 20
0.165 40
475views - Textbook QuestionAbout 1% of occurrences of nonautoimmune type 1 diabetes are due to loss-of-function alleles in the insulin gene. Individuals heterozygous for such mutations develop diabetes as infants or in the first few years of their lives. Outline how you might approach gene therapy for such a disease and what difficulties you might encounter.347views
- Textbook Question
In humans, congenital heart disease is a common birth defect that affects approximately 1 out of 125 live births. Using reverse transcription PCR (RT-PCR), Samir Zaidi and colleagues [(2013) Nature 498:220.223] determined that approximately 10 percent of the cases resulted from point mutations, often involving histone function. To capture products of gene expression in developing hearts, they used oligo(dT) in their reverse transcription protocol.
If one were interested in comparing the quantitative distribution of gene expression in, say, the right and left sides of a developing heart, how might one proceed using RT-PCR?
517views