We usually think of enzymes as being most active at around 37°C, yet in PCR the DNA polymerase is subjected to multiple exposures of relatively high temperatures and seems to function appropriately at 65–75°C. What is special about the DNA polymerase typically used in PCR?
18. Molecular Genetic Tools
Genetic Cloning
- Textbook Question450views
- Textbook Question
Traditional Sanger sequencing has largely been replaced in recent years by next-generation and third-generation sequencing approaches. Describe advantages of these sequencing methods over first-generation Sanger sequencing.
435views - Textbook Question
Given your knowledge of the genetic tools for studying Drosophila, outline a method by which you could clone the dunce and rutabaga genes identified by Seymour Benzer's laboratory in the genetic screen.
447views - Textbook Question
How is fluorescent in situ hybridization (FISH) used to produce a spectral karyotype?
721views - Textbook Question
You have generated three transgenic lines of maize that are resistant to the European corn borer, a significant pest in many regions of the world. The transgenic lines (T₁ in the accompanying table) were created using Agrobacterium-mediated transformation with a T-DNA having two genes, the first being a gene conferring resistance to the corn borer and the second being a gene conferring resistance to a herbicide that you used as a selectable marker to obtain your transgenic plants. You crossed each of the lines to a wild-type maize plant and also generated a T2 population by self-fertilization of the T1 plant. The following segregation results were observed (herbicide resistant : herbicide sensitive):
Explain these segregation ratios.
494views - Textbook Question
How would you clone a gene that you have identified by a mutant phenotype in Drosophila?
666views - Textbook Question
Bacterial Pseudomonas species often possess plasmids encoding genes involved in the catabolism of organic compounds. You have discovered a strain that can metabolize crude oil and wish to identify the gene(s) responsible. Outline an experimental protocol to find the gene or genes required for crude oil metabolism.
453views - Textbook Question
Microsatellites are currently exploited as markers for paternity testing. A sample paternity test is shown in the following table in which ten microsatellite markers were used to test samples from a mother, her child, and an alleged father. The name of the microsatellite locus is given in the left-hand column, and the genotype of each individual is recorded as the number of repeats he or she carries at that locus. For example, at locus D9S302, the mother carries 30 repeats on one of her chromosomes and 31 on the other. In cases where an individual carries the same number of repeats on both chromosomes, only a single number is recorded. (Some of the numbers are followed by a decimal point, for example, 20.2, to indicate a partial repeat in addition to the complete repeats.) Assuming that these markers are inherited in a simple Mendelian fashion, can the alleged father be excluded as the source of the sperm that produced the child? Why or why not? Explain.
872views - Textbook Question
Two complaints about some transgenic plants presently in commercial use are that (1) the Bt toxin gene is constitutively expressed in them, leading to fears that selection pressures will cause insects to evolve resistance to the toxin, and (2) a selectable marker gene—for example, conferring kanamycin resistance—remains in the plant, leading to concerns about increased antibiotic resistance in organisms in the wild. How would you generate transgenic plants that produce Bt only in response to being fed upon by insects and without the selectable marker?
366views - Textbook Question
The highlighted sequence shown below is the one originally used to produce the B chain of human insulin in E. coli. The sequence of the human gene encoding the B chain of insulin was later determined from a cDNA isolated from a human pancreatic cDNA library and is also shown below, without highlighting. Explain the differences between the two sequences.
ATGTTCGTCAATCAGCACCTTTGTGGTTCTCACCTCGTTGAAGCTTTGTACCTTGTTTGCGGTGAACGTGGTTTCTTCTACACTCCTAAGACTTAA
GCCTTTGTGAACCAACACCTGTGCGGCTCACACCTGGTGGAAGCTCTCTACCTAGTGTGCGGGGAACGAGGCTTCTTCTACACACCCAAGACCCGC582views - Textbook Question
The CRISPR-Cas system has great potential but also raises many ethical issues about its potential applications because, theoretically, it can be used to edit any gene in the genome. What do you think are some of the concerns about the use of CRISPR-Cas on humans? Should CRISPR-Cas applications be limited for use on only certain human genes but not others? Explain your answers.
575views - Textbook Question
Vitamin E is the name for a set of chemically related tocopherols, which are lipid-soluble compounds with antioxidant properties. Such antioxidants protect cells against the effects of free radicals created as by-products of energy metabolism in the mitochondrion. Different tocopherols have different biological activities due to differences in their retention by binding to gut proteins during digestion. The one retained at the highest level is α-tocopherol, whereas γ-tocopherol is retained at less than 10% of that efficiency. In Arabidopsis, α-tocopherol is the most abundant tocopherol in leaves, whereas γ-tocopherol is the most abundant in seeds. An enzyme encoded by the VTE4 gene can convert γ-tocopherol to α-tocopherol. How would you create an Arabidopsis plant that produces high levels of α-tocopherol in the seeds?
447views - Textbook Question
The gel presented here shows the pattern of bands of fragments produced with several restriction enzymes. The enzymes used are identified above the lanes of the gel, and six possible restriction maps are shown in the column to the right.
One of the six restriction maps shown is consistent with the pattern of bands shown in the gel.
The highlighted bands (magenta) in the gel were hybridized with a probe for the gene pep during a Southern blot. Where in the gel is the pep gene located?
654views - Textbook Question
The gel presented here shows the pattern of bands of fragments produced with several restriction enzymes. The enzymes used are identified above the lanes of the gel, and six possible restriction maps are shown in the column to the right.
One of the six restriction maps shown is consistent with the pattern of bands shown in the gel.
From your analysis of the pattern of bands on the gel, select the correct restriction map and explain your reasoning.
544views - Textbook Question
The RAS gene encodes a signaling protein that hydrolyzes GTP to GDP. When bound by GDP, the RAS protein is inactive, whereas when bound by GTP, RAS protein activates a target protein, resulting in stimulation of cells to actively grow and divide. As shown in the accompanying sequence, a single base-pair mutation results in a mutant protein that is constitutively active, leading to continual promotion of cell proliferation. Such mutations play a role in the formation of cancer. You have cloned the wild-type version of the mouse RAS gene and wish to create a mutant form to study its biological activity in vitro and in transgenic mice. Outline how you would proceed.
713views